View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809R-Insertion-23 (Length: 256)
Name: NF1809R-Insertion-23
Description: NF1809R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809R-Insertion-23 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 104 - 256
Target Start/End: Complemental strand, 275534 - 275381
Alignment:
| Q |
104 |
attaatgcatgtt-gttttatgatatgtaggttgataggataaatgctgaaggttattatggaggagttcgattgcttatggctatttataaagtttttt |
202 |
Q |
| |
|
||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
275534 |
attaatgcatgtttgtgttatgatatgcaggttgataggataaatgctgaaggttattatggaggagttcgattgcttatggctatttataaagtttttt |
275435 |
T |
|
| Q |
203 |
ataattattgtaaagataataatattcatcttcatcataccaatttcactcttt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
275434 |
ataattattgtaaagataataatattcatcttcatcataccaatttcactcttt |
275381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 39
Target Start/End: Complemental strand, 275586 - 275554
Alignment:
| Q |
7 |
catgtccatcttttgttctcattatcatcatct |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
275586 |
catgtccatcttttgttctcattatcatcatct |
275554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University