View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809R-Insertion-25 (Length: 144)
Name: NF1809R-Insertion-25
Description: NF1809R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809R-Insertion-25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 2e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 8645834 - 8645891
Alignment:
| Q |
7 |
cagttctaattgcatttccaaacttgcttgagtgtgccttttgggcatatccacagta |
64 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8645834 |
cagttctaattgcattttcaaacttgcttgagtgtgccttttgggcatatccacagta |
8645891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 28; Significance: 0.0000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 82 - 121
Target Start/End: Original strand, 26279311 - 26279350
Alignment:
| Q |
82 |
aaaaaattatagctcaataatactactaactactactcca |
121 |
Q |
| |
|
|||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
26279311 |
aaaaaattatagctcagtagtactactaaatactactcca |
26279350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University