View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809R-Insertion-27 (Length: 89)
Name: NF1809R-Insertion-27
Description: NF1809R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809R-Insertion-27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 9e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 9e-36
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 42786930 - 42786851
Alignment:
| Q |
10 |
atatatgaatgaagtggcagatatatgttttgcattgatccctatgtatatgtgcttggactgaaggggagctccttctt |
89 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42786930 |
atatatgaatgaagtggaagatatatgttttgcattgatccctatgtatatgtgcttggactgaaggggagctccttctt |
42786851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University