View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809R-Insertion-29 (Length: 46)
Name: NF1809R-Insertion-29
Description: NF1809R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809R-Insertion-29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 38; Significance: 0.0000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 9 - 46
Target Start/End: Complemental strand, 47354887 - 47354850
Alignment:
| Q |
9 |
tcagcatgcacattgcacaagttgttttacgtggctct |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47354887 |
tcagcatgcacattgcacaagttgttttacgtggctct |
47354850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.00000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.00000000004
Query Start/End: Original strand, 9 - 46
Target Start/End: Complemental strand, 37306431 - 37306394
Alignment:
| Q |
9 |
tcagcatgcacattgcacaagttgttttacgtggctct |
46 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37306431 |
tcagcatgcacattgcacaagttgtgttacgtggctct |
37306394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University