View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_high_33 (Length: 251)
Name: NF1809_high_33
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 28266365 - 28266604
Alignment:
| Q |
1 |
aataattatctctttacaaggtaaaagaatagagttgggctccacaannnnnnnnccttccatctctataagagattcaaacaatgaaaagtgtcttttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28266365 |
aataattatctctttacaaggtaaaagaatagagttgggctccacaaatttttt-ccttccatctctataagagattcaaacaatgaaaagtgtcttttt |
28266463 |
T |
 |
| Q |
101 |
caatcaagtttatttcccattttttcttactttctttccatcaccataatggtcaaaaatagttacttgatcatgttagatggaccctttcaacatagta |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28266464 |
caattaagtttatttcccattttttcttactttctttccatcaccatgatggtcaaaaatagttacttgatcatgttagatggaccctttcaacatagta |
28266563 |
T |
 |
| Q |
201 |
tggaactggattggtcctttttgaatccatacttacctttg |
241 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28266564 |
tggaagtggattggtcctttttgaatccatacttacctttg |
28266604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University