View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_high_38 (Length: 241)
Name: NF1809_high_38
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 7 - 188
Target Start/End: Original strand, 36769519 - 36769700
Alignment:
| Q |
7 |
aaaaatatgagttaaaaccaaaattgcaacaaatttgacaattgaatgattnnnnnnnttgaagaccggaatattcgattttaaaaagaggagactattt |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36769519 |
aaaaatatgggttaaaaccaaaattgcaacaaatttgacaatcgaatgattaaaaaaattgaagaccggaatattcgattttaaaaagaggagactattt |
36769618 |
T |
 |
| Q |
107 |
ttgtaagtttaaaaaatataggatgaaaagtaaaattaagccaatattttaactattggccaaacttccactttttttatgt |
188 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
36769619 |
ttgtaagcttaaaaaatataggatgaaaagtaaaattaagccaatattttaactattgcccaaacttccactctttttatgt |
36769700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University