View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1809_high_43 (Length: 237)

Name: NF1809_high_43
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1809_high_43
NF1809_high_43
[»] chr4 (2 HSPs)
chr4 (117-221)||(2207520-2207624)
chr4 (120-221)||(2208967-2209068)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 117 - 221
Target Start/End: Original strand, 2207520 - 2207624
Alignment:
117 gcattacttgttggatgattctacgtttattatgaccagcagcaagatcatcaagattaacaatcttcttaatattggtttgcatatctctaacaagctt 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
2207520 gcattacttgttggatgattctacgtttattatgaccagcagcaagatcatcaagattaacaatcttcttaatattggtttgcatatccctaacaagctt 2207619  T
217 gaatt 221  Q
    |||||    
2207620 gaatt 2207624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 120 - 221
Target Start/End: Original strand, 2208967 - 2209068
Alignment:
120 ttacttgttggatgattctacgtttattatgaccagcagcaagatcatcaagattaacaatcttcttaatattggtttgcatatctctaacaagcttgaa 219  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2208967 ttacttgttggatgattctacgtttattatgaccagcaacaagatcatcaagattaacaatcttcttaatattggtttgcatatctctaacaagcttgaa 2209066  T
220 tt 221  Q
    ||    
2209067 tt 2209068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University