View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_high_47 (Length: 230)
Name: NF1809_high_47
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_high_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 26 - 141
Target Start/End: Original strand, 42200332 - 42200448
Alignment:
| Q |
26 |
ttggatgctccctagcatgtgacgggttagtatctttttaccaattccggattcgtcttgtgtggaattggaactaatgaaattttattagccgat-aat |
124 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42200332 |
ttggatgctccctagcatgtgacgggtcagtatctttttaccaattccggattcgtcttgtgtggaattggaactaatgaaattttattagccgataaat |
42200431 |
T |
|
| Q |
125 |
aaagaactttgaatgtc |
141 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42200432 |
aaagaactttgaatgtc |
42200448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 25 - 88
Target Start/End: Complemental strand, 49361091 - 49361028
Alignment:
| Q |
25 |
cttggatgctccctagcatgtgacgggttagtatctttttaccaattccggattcgtcttgtgt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||| ||||||||||||| |||||||| |
|
|
| T |
49361091 |
cttggatgctccctagcatgtgacgggtcaatatctttttagcaattccggattcatcttgtgt |
49361028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University