View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_high_49 (Length: 223)
Name: NF1809_high_49
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_high_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 108 - 208
Target Start/End: Original strand, 12298658 - 12298755
Alignment:
| Q |
108 |
ctattgattaacagtagcactgttattttacttccttagaaattaacaaagaattattataagagtacatgtgagcaataattaaaagagattgacataa |
207 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12298658 |
ctattgtttaacagtagcactggtattttacttccttagaaattagcaaagaattattataagagtacatgtgagc---aattaaaagagattgacataa |
12298754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University