View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_high_53 (Length: 214)
Name: NF1809_high_53
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_high_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 8 - 200
Target Start/End: Complemental strand, 21841013 - 21840821
Alignment:
| Q |
8 |
agatgaagaagatggttgcagaacttcatcaccgtcgtcgtcgttatcagaagcagaagagaagctcaaagagaaagatgatgaagaagatggtttcaga |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21841013 |
agatgaagaagatggtttcagaacttcatcactgtcgttgtcgttatcagaagcagaagagaagctcaaagagaaagatgatgaagaagatggttttaga |
21840914 |
T |
|
| Q |
108 |
actccaacatctttggaccacaagatttcagtgctcacatgtccacttgcaccaaagaaaatgaaacagtcactgaaaaggagagcagaacct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21840913 |
actccaacatctttggaccacaagatttcagtgctcacatgtccacttgcaccaaagaaaatgaaacagtcactgaaaaggagagcagaacct |
21840821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 21841043 - 21840989
Alignment:
| Q |
53 |
atcagaagcagaagagaagctcaaagagaaagatgatgaagaagatggtttcagaact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21841043 |
atcagaagcagaagagaagctcaaagagaaag---atgaagaagatggtttcagaact |
21840989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University