View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_high_57 (Length: 211)
Name: NF1809_high_57
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_high_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 2108885 - 2109063
Alignment:
| Q |
14 |
aaatagataaaacaaaaaagaagctaatttaaccagatttgtaaataaacagaagggttaaataagtttttagttcttattataaatataacgaatttta |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2108885 |
aaatagataaaacaaaaaagaagctactttaaccagatttgtaaataaacagatgagttaaataagtttttagttcttattataaatataacgaatttta |
2108984 |
T |
 |
| Q |
114 |
tagggatcaaaacataacagnnnnnnnnatgaggactaaaacgaaattgattatatttatagaacaaggagaaccgggag |
193 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2108985 |
tagggatcaaaacatgtcag-tttttttataaggactaaaacgaaattgattatatttatagaacaagcagaaccgggag |
2109063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University