View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_low_34 (Length: 255)
Name: NF1809_low_34
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 489108 - 489163
Alignment:
| Q |
99 |
aaatgaaagaaactagtagttttgttgacctggactataagctccaatcagtgtgt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
489108 |
aaatgaaagaaactagtagttttgttgacctggactataagctccaatcagtgtgt |
489163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 489052 - 489112
Alignment:
| Q |
1 |
atattttgaatattatagtactcagcaagaatatataagaaattaagctaaaggattttgaaatg |
65 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
489052 |
atattttgaatattatagtactaagcaagaata----agaaattaagctaaaggattttgaaatg |
489112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University