View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_low_44 (Length: 239)
Name: NF1809_low_44
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 28266252 - 28266138
Alignment:
| Q |
107 |
aacgaaacaaatttaactgactgtcgttaataaaaaattgttcaatacaagtaggaggaattttaaaaacatatagtgactaacccaaaaatatacctcc |
206 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||| || |
|
|
| T |
28266252 |
aacgaaacaaatttaactga-tgtcattaataaaaaattgttcaatacaagtaggaggaattttaaaaac--attgtgactaacccaaaaacataccgcc |
28266156 |
T |
 |
| Q |
207 |
--attcattcctaacatc |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28266155 |
atattcattcctaacatc |
28266138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University