View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_low_46 (Length: 237)
Name: NF1809_low_46
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 117 - 221
Target Start/End: Original strand, 2207520 - 2207624
Alignment:
| Q |
117 |
gcattacttgttggatgattctacgtttattatgaccagcagcaagatcatcaagattaacaatcttcttaatattggtttgcatatctctaacaagctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2207520 |
gcattacttgttggatgattctacgtttattatgaccagcagcaagatcatcaagattaacaatcttcttaatattggtttgcatatccctaacaagctt |
2207619 |
T |
 |
| Q |
217 |
gaatt |
221 |
Q |
| |
|
||||| |
|
|
| T |
2207620 |
gaatt |
2207624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 120 - 221
Target Start/End: Original strand, 2208967 - 2209068
Alignment:
| Q |
120 |
ttacttgttggatgattctacgtttattatgaccagcagcaagatcatcaagattaacaatcttcttaatattggtttgcatatctctaacaagcttgaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2208967 |
ttacttgttggatgattctacgtttattatgaccagcaacaagatcatcaagattaacaatcttcttaatattggtttgcatatctctaacaagcttgaa |
2209066 |
T |
 |
| Q |
220 |
tt |
221 |
Q |
| |
|
|| |
|
|
| T |
2209067 |
tt |
2209068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University