View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_low_47 (Length: 235)
Name: NF1809_low_47
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 177
Target Start/End: Original strand, 51239077 - 51239239
Alignment:
| Q |
18 |
tatgtaatagtaa-ttctaaactatgcagaagagtggtttcgactcaaggaatgtaatctaatgtaaaattctcttgat--tagaagtgcagtgtctctt |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
51239077 |
tatgtaatagtaaattctaaactatgcagaagagtggtttcgactcaaggaatgtaatctaatgtaaaattttcttgatattagaagtgcagtgtctctt |
51239176 |
T |
|
| Q |
115 |
ctcttctcttccttggaatcgatggttttggaacttcgttaattatgacttccagttcacata |
177 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51239177 |
ctcttctcttccttggaatcgatagttttggaacttcgttaattatgacttccagttcacata |
51239239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Original strand, 51239387 - 51239429
Alignment:
| Q |
176 |
tatgtactaactgtcgtctgtcacttacgattggactctcatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51239387 |
tatgtactaactgtcgtctgtcacttacgattggactctcatc |
51239429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 176 - 218
Target Start/End: Original strand, 38594488 - 38594530
Alignment:
| Q |
176 |
tatgtactaactgtcgtctgtcacttacgattggactctcatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38594488 |
tatgtactaactgtcgtctgtcacttacgattggactctcatc |
38594530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University