View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1809_low_54 (Length: 221)

Name: NF1809_low_54
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1809_low_54
NF1809_low_54
[»] chr3 (1 HSPs)
chr3 (15-202)||(48846895-48847082)
[»] chr4 (1 HSPs)
chr4 (139-202)||(55246062-55246125)
[»] chr6 (1 HSPs)
chr6 (166-202)||(1634601-1634637)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 48847082 - 48846895
Alignment:
15 aatatccaaagcagaaacttcaaaattctgggagacaggttaatccacaaacactctcataattgttgctcttctatgacagtcttgcttctctgctcct 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48847082 aatatccaaagcagaaacttcaaaattctgggagacaggttaatccacaaacactctcataattgttgctcttctatgacagtcttgcttctctgctcct 48846983  T
115 caacaaccacatgttgtaagaacggtatgtcattctgctatactttgactgatactaatttctatgttctcaccaatcatggaggacc 202  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48846982 caacaaccacatgttgtaacaacggtatgtcattctgctatactttgactgatactaatttctatgttctcaccaatcatggaggacc 48846895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 139 - 202
Target Start/End: Original strand, 55246062 - 55246125
Alignment:
139 gtatgtcattctgctatactttgactgatactaatttctatgttctcaccaatcatggaggacc 202  Q
    |||| ||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||    
55246062 gtatatcattctgctatactttgactcatactcatttctatgttcttaccaatcatggaggacc 55246125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 202
Target Start/End: Original strand, 1634601 - 1634637
Alignment:
166 atactaatttctatgttctcaccaatcatggaggacc 202  Q
    ||||| |||||||||||||||||||||||||||||||    
1634601 atactcatttctatgttctcaccaatcatggaggacc 1634637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University