View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809_low_56 (Length: 217)
Name: NF1809_low_56
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809_low_56 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 10 - 181
Target Start/End: Original strand, 33391759 - 33391941
Alignment:
| Q |
10 |
tcgaagaatatatagtttactaccttttataaagaaaaatggtatttagttatcatcaaag-----------gcaattactaaatgtctaaagaacaact |
98 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33391759 |
tcgaacaatatatagtttactaccttttataaagaaaaatggtatttagttatcatcaaaggcattttaaaggcaattactaaatgtctaaagaacaact |
33391858 |
T |
|
| Q |
99 |
ttcatattaatattttaaacgataaacttgagacttttgagattttgggtgctaaagataaactcccatgatttcatggcacc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33391859 |
ttcatattaatattttaaacgataaacttgagacttttgagattttgggtgctaaagataaactcccatgatttcatggcacc |
33391941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University