View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1809_low_62 (Length: 208)

Name: NF1809_low_62
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1809_low_62
NF1809_low_62
[»] chr7 (1 HSPs)
chr7 (1-208)||(33904299-33904506)


Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 33904506 - 33904299
Alignment:
1 tacctaacaaatctgtctgtgctggatcttagtaattaattagtgttgcttcttcaaaccaaaatgcacataaatgaaatttaatgcctatggtacctta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33904506 tacctaacaaatctgtctgtgctggatcttagtaattaattagtgttgcttcttcaaaccaaaatgcacataaatgaaatttaatgcctatggtacctta 33904407  T
101 gagaaaggacaacatcttgatacattacacttagttgagcaaaagtatgatatagaggaattcaagacacctaagactaccctggataaccttgaggaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33904406 gagaaaggacaacatcttgatacattacacttagttgagcaaaagtatgatatagaggaattcaagacacctaagactaccctggataaccttgaggaaa 33904307  T
201 cagcaaca 208  Q
    ||||||||    
33904306 cagcaaca 33904299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University