View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18100_high_7 (Length: 277)
Name: NF18100_high_7
Description: NF18100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18100_high_7 |
 | |
|
| [»] scaffold0068 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 13878539 - 13878289
Alignment:
| Q |
18 |
agatattagttagattgcctgcaaagtcacttatgcgttttaaatgtgttcaacgatcttggaacattcttttcaagaaccctaaatttgttattaggaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13878539 |
agatattagttagattgcctgcaaagtcacttatgcgttttaaatgtgttcaaagatcttggaacattcttttcaagaaccctaaatttgttattaggaa |
13878440 |
T |
|
| Q |
118 |
catgcatatccatatgtctaatgatgatgatgaccaccatcgtttcgtgatcattaaacagtatacaaaagaaacatgccctaaaacccataaccacaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13878439 |
catgcatatccatatgtctaatgatgatgatgaccaccatcgtttcgttatcattaaacagtatacaaaagaaacatgccctaaaacccataaccacaat |
13878340 |
T |
|
| Q |
218 |
gacaggatctttgacaagcccattgaatcaacttgcctagaaacccaccta |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13878339 |
gacaggatctttgacaagcccattgaatcaacttgcctagaaacccaccta |
13878289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 19071423 - 19071467
Alignment:
| Q |
18 |
agatattagttagattgcctgcaaagtcacttatgcgttttaaat |
62 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19071423 |
agatattagttagatttcctgcaaagtcacttatgcgttttaaat |
19071467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 19119313 - 19119357
Alignment:
| Q |
18 |
agatattagttagattgcctgcaaagtcacttatgcgttttaaat |
62 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19119313 |
agatattagttagatttcctgcaaagtcacttatgcgttttaaat |
19119357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 34169207 - 34169256
Alignment:
| Q |
44 |
tcacttatgcgttttaaatgtgttcaacgatcttggaacattcttttcaa |
93 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
34169207 |
tcactaatgcgtttcaaatgcgttcaacgatcttggaacattctattcaa |
34169256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 58966 - 59015
Alignment:
| Q |
18 |
agatattagttagattgcctgc-----aaagtcacttatgcgttttaaat |
62 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
58966 |
agatattagttagattgcctgcaagtgaaagtcacttatgcgttttaaat |
59015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University