View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18101_high_3 (Length: 225)
Name: NF18101_high_3
Description: NF18101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18101_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 32235557 - 32235751
Alignment:
| Q |
18 |
atcacatagtaaatgtttaagcaatgttgtcaaaactggaccaaaccggccggttcaactggttgaattgagaatcagctagtcttttggttggttcaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
32235557 |
atcacatagtaaatgtttaagcaatgttgtcaaaactggaccaaaccggccggttcaactggttgattagagaatcagctagtcttttggttggttcaac |
32235656 |
T |
 |
| Q |
118 |
catagttcggtagagccagatcaaactaggttgaaccacaattggttagttagaccaattgaaccatgactcagaaatttcaccggtttcatctc |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32235657 |
catagtttggtagagccagatcaaactaggttgaaccacaattggttagttagaccaattgaaccatgactcagaagtttcaccggtttcatctc |
32235751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University