View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18102_low_10 (Length: 246)

Name: NF18102_low_10
Description: NF18102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18102_low_10
NF18102_low_10
[»] chr7 (3 HSPs)
chr7 (190-246)||(39266040-39266096)
chr7 (39-84)||(39266128-39266172)
chr7 (11-43)||(39266203-39266235)
[»] chr1 (2 HSPs)
chr1 (37-117)||(49156080-49156159)
chr1 (197-244)||(49155939-49155986)


Alignment Details
Target: chr7 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 190 - 246
Target Start/End: Complemental strand, 39266096 - 39266040
Alignment:
190 atgttgcgagtttgatgctttataattgttggaagagatgaatttagtgttatgaac 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39266096 atgttgcgagtttgatgctttataattgttggaagagatgaatttagtgttatgaac 39266040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 39 - 84
Target Start/End: Complemental strand, 39266172 - 39266128
Alignment:
39 gtttttaatgtttgtgagatttgatattgagatcattttggtttga 84  Q
    ||||||||||||||||||||||||| |||| |||||||||||||||    
39266172 gtttttaatgtttgtgagatttgattttga-atcattttggtttga 39266128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 39266235 - 39266203
Alignment:
11 cagagatggtaaaatcactattgaatgagtttt 43  Q
    |||||||||||||||||||||||| ||||||||    
39266235 cagagatggtaaaatcactattgattgagtttt 39266203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 37 - 117
Target Start/End: Complemental strand, 49156159 - 49156080
Alignment:
37 gagtttttaatgtttgtgagatttgatattgagatcattttggtttgaatctttatgttacgtttcatggatctggatgtg 117  Q
    ||||||||| |||||||||||| |||| |||| ||||||  ||||||||| |||| ||| |||||||||||||| ||||||    
49156159 gagtttttactgtttgtgagatctgattttgaaatcattgcggtttgaat-tttaagttgcgtttcatggatctagatgtg 49156080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 244
Target Start/End: Complemental strand, 49155986 - 49155939
Alignment:
197 gagtttgatgctttataattgttggaagagatgaatttagtgttatga 244  Q
    |||||||||||||||||||| |||||||| ||| ||||||||||||||    
49155986 gagtttgatgctttataattattggaagaaatggatttagtgttatga 49155939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University