View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18102_low_11 (Length: 212)
Name: NF18102_low_11
Description: NF18102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18102_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 28 - 190
Target Start/End: Complemental strand, 4111662 - 4111500
Alignment:
| Q |
28 |
tgtcactgtgtccgaacctagttgtttgatatgaagatgaagattgtgccttccaagtttgcctcccgagcttacctttgtaagctcgtatgtactagat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4111662 |
tgtcactgtgtccgaacctagttgtttgatatgaagatgaagattgtgccttccaagtttgcctcccgagcttacctctgtaagctcgtatgtactagat |
4111563 |
T |
|
| Q |
128 |
gattcctgcaaacaattaccaaagaatcacaaaccaatcatgtcaatgttcttctacatatcc |
190 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4111562 |
gattcctgcaaacaattaacaaagaatcacaaaccaatcatgtcaatgttcttctacatatcc |
4111500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 28 - 196
Target Start/End: Original strand, 4768322 - 4768484
Alignment:
| Q |
28 |
tgtcactgtgtccgaacctagttgtttgatatgaagatgaagattgtgccttccaagtttgcctcccgagcttacctttgtaagctcgtatgtactagat |
127 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
4768322 |
tgtcactgtgtccggacctagttgtttgatatga------agattgtgtcttccaagtttgcctcctgtgcttacctctgtaagctcgtatgtactagat |
4768415 |
T |
|
| Q |
128 |
gattcctgcaaacaattaccaaagaatcacaaaccaatcatgtcaatgttcttctacatatccaccctt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4768416 |
gattcctgcaaacaattaccaaagaatcacaaaccaatcatgtcaagtttcttctacatatccaccctt |
4768484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 73 - 190
Target Start/End: Original strand, 4383186 - 4383303
Alignment:
| Q |
73 |
gtgccttccaagtttgcctcccgagcttacctttgtaagctcgtatgtactagatgattcctgcaaacaattaccaaagaatcacaaaccaatcatgtca |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4383186 |
gtgccttccaagtttgcctcccgagcttacctctgtaagctcgtatgtactagatgattcctgcaaacaattaacaaagaatcacaaaccaatcatgtca |
4383285 |
T |
|
| Q |
173 |
atgttcttctacatatcc |
190 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4383286 |
atgttcttctacatatcc |
4383303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University