View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18103_high_23 (Length: 300)
Name: NF18103_high_23
Description: NF18103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18103_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 44285745 - 44285890
Alignment:
| Q |
1 |
cacctttactctctgtctcaatcgagccggtcagatcaatagagaagtcaggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
44285745 |
cacctttactctctgtctcaatcaattcggtcagatcaatagagaagtcaggcactcgattgacttaaaggaagattccg-ccgtaaattgattgatcaa |
44285843 |
T |
|
| Q |
101 |
tgttaccgggaagcagcaacagagacagattgagtgctaaagcttct |
147 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
44285844 |
tgttaccgggaagcagcaacagagatggattgagtactaaagcttct |
44285890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 44070268 - 44070126
Alignment:
| Q |
1 |
cacctttactctctgtctcaatcgagccggtcagatcaatagagaagtcaggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||| |||| ||||| | |
|
|
| T |
44070268 |
cacctttactctctgtctcaatctagccggtcagatcaatagagaagtcaggcacttgattgacttaaaggaaggttccg-ccgttaattgattgattga |
44070170 |
T |
|
| Q |
101 |
tgttaccgggaagcagcaacagagacagattgagtgctaaagct |
144 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44070169 |
tgttgccaggaagcagcaacagagacagattgagtactaaagct |
44070126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 49 - 144
Target Start/End: Complemental strand, 16443843 - 16443749
Alignment:
| Q |
49 |
caggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagct |
144 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| || |||| ||||| ||||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16443843 |
caggcacttgattgacttaaaggaaggttccgcc-gttaattgattgattgatgttgccaggaagcagcaacagagacagattgagtactaaagct |
16443749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University