View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18104_high_9 (Length: 218)
Name: NF18104_high_9
Description: NF18104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18104_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 164
Target Start/End: Complemental strand, 49082483 - 49082336
Alignment:
| Q |
17 |
cagagattgatggtagatcgacttctgttaatacgagatctatgtcaagtgatttattctttaatgtttcccatgcctttaacccatcacgaactgctgc |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49082483 |
cagagattgatgggagatcgacttctgttaatacgagatctatgtcaagtgatttattctttaatgtttcccatgcctttaacccatcacgaacagctgc |
49082384 |
T |
 |
| Q |
117 |
aactgcatttaaaaaattaaagcattaaaggcatggtggagaataata |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49082383 |
aactgcatttaaaaaattaaagcattaaaggcatggtggagaataata |
49082336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University