View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18104_low_11 (Length: 342)
Name: NF18104_low_11
Description: NF18104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18104_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 5 - 180
Target Start/End: Original strand, 9580976 - 9581151
Alignment:
| Q |
5 |
ggcaaatctctatgtcagagctgtgccacctgcggagctgaacaggatcacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctc |
104 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9580976 |
ggcaaatctctatgtcaaagctgtgccacctgcggatctgaacaggaacacagaatggtttacgtatcctggtgtttggacaacatatattctcatcctc |
9581075 |
T |
|
| Q |
105 |
ttcttttcatggatcatggttttgtctgtctttggttgttctcctgggattgcttggactattgttaatctcgctc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9581076 |
ttcttttcatggatcatggttttgtctgtctttggttgttctcctgggattgcttggactattgttaatctcgctc |
9581151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University