View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18104_low_18 (Length: 254)
Name: NF18104_low_18
Description: NF18104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18104_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 7905643 - 7905862
Alignment:
| Q |
16 |
ggaggatctacaaatatccatgttccagttgcttccaaagcactaaagctcaggagacatagcaagttgccaacgtggatcactttgggcctgtttaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905643 |
ggaggatctacaaatatccatgttccagttgcttccaaagcactaa-gctcaggggacatagcaagttgccaacgtggatcactttgggcctgtttaaaa |
7905741 |
T |
|
| Q |
116 |
gaagaaggttcaatgtctgatgagatggcaagagtgaagctacaatatgagggagataacgggtgataagacaaggaagcggagatgggaaagagctgag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7905742 |
gaagaaggttcaatgtctgatgagatggcaagagtgaagctacaatatgagggagataacgggtgataagacaaggaagcggagatggg-aagagctgag |
7905840 |
T |
|
| Q |
216 |
caaacaaagtcttgaagatgag |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7905841 |
caaacaaagtcttgaagatgag |
7905862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University