View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18105_low_20 (Length: 209)

Name: NF18105_low_20
Description: NF18105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18105_low_20
NF18105_low_20
[»] chr2 (2 HSPs)
chr2 (128-209)||(38940200-38940281)
chr2 (13-62)||(38940347-38940396)


Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 128 - 209
Target Start/End: Complemental strand, 38940281 - 38940200
Alignment:
128 gagaagaaatagcgatgacgaattaccgagaagatgttcgagctaaaacctgaaacggaacgaagattcatcagtgagtgaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38940281 gagaagaaatagcgatgacgaattaccgagaagatgttcgagctaaaacctgaaacggaacgaagattcatcagtgagtgaa 38940200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 13 - 62
Target Start/End: Complemental strand, 38940396 - 38940347
Alignment:
13 aatatcagaaatagaaaccaaaatattcatacagtatatcaagtgcagac 62  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
38940396 aatatcagaaatagaaaccaaaatattcatacagtatatcaagtgcagac 38940347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University