View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18105_low_20 (Length: 209)
Name: NF18105_low_20
Description: NF18105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18105_low_20 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 128 - 209
Target Start/End: Complemental strand, 38940281 - 38940200
Alignment:
| Q |
128 |
gagaagaaatagcgatgacgaattaccgagaagatgttcgagctaaaacctgaaacggaacgaagattcatcagtgagtgaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940281 |
gagaagaaatagcgatgacgaattaccgagaagatgttcgagctaaaacctgaaacggaacgaagattcatcagtgagtgaa |
38940200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 13 - 62
Target Start/End: Complemental strand, 38940396 - 38940347
Alignment:
| Q |
13 |
aatatcagaaatagaaaccaaaatattcatacagtatatcaagtgcagac |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940396 |
aatatcagaaatagaaaccaaaatattcatacagtatatcaagtgcagac |
38940347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University