View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18105_low_21 (Length: 206)
Name: NF18105_low_21
Description: NF18105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18105_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 15854900 - 15854727
Alignment:
| Q |
18 |
agctcccacattgcatgatgagtttttatttttacagttagtg--atgtagacaaaatgacaaacatcacttaaatctgacatacgtcggatatggtggt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
15854900 |
agctcccacattgcatgatgagtttttatttttacagtttgtgtgatgtagacaaaatgacaaacaccacttaaatctgacatacgtcggatatggcggt |
15854801 |
T |
|
| Q |
116 |
gtcatatgtcggatttttggctttccgccatcgataatattgcttagtgttctgctttacttatctggattctg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15854800 |
gtcatatgtcggatttttggctttccgccatcgataatattgcttagtgttctgctttacttatctggattctg |
15854727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 157
Target Start/End: Complemental strand, 29032107 - 29032071
Alignment:
| Q |
121 |
atgtcggatttttggctttccgccatcgataatattg |
157 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
29032107 |
atgtcggatctttggctttccgccatcgataacattg |
29032071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 25868964 - 25868924
Alignment:
| Q |
120 |
tatgtcggatttttggctttccgccatcgataatattgctt |
160 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
25868964 |
tatgtcggatttttggctttccgccattgataacattgctt |
25868924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University