View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18106_high_15 (Length: 295)
Name: NF18106_high_15
Description: NF18106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18106_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 32630900 - 32630626
Alignment:
| Q |
19 |
tagagatcaactatgttgaatccttcagagagcaaatattagcttgttatcatggggctcaactttgcaaactgctgtggaggtttcctttccctatctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32630900 |
tagagatcaactatgttgaatccttcagagagcaaatattagcttgttatcatggggctcaactttgcaaactgctgtggaggtttcctttccctatctt |
32630801 |
T |
|
| Q |
119 |
ttgggatttcctccactgcctctcaccttccacaaccaatatggattccatcagtttttcctcgcccaaatcaagtcttttgccgcattttaactcgcca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32630800 |
ttgggatttcctccactgcctctcaccttccacaaccaatatggattccatcagtttttcctcgcccaaatcaagtcttttgccgcattttaactcgcca |
32630701 |
T |
|
| Q |
219 |
ctaatcactggtttgtatctttcagtttccacatcaaacttatgatccctccctattatatgtatctgtgctgct |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
32630700 |
ctaatcactggtttgtatctttcagtttccacatcaaacttatgatccctccctactatatgtatctttgctgct |
32630626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 19 - 133
Target Start/End: Complemental strand, 32656851 - 32656737
Alignment:
| Q |
19 |
tagagatcaactatgttgaatccttcagagagcaaatattagcttgttatcatggggctcaactttgcaaactgctgtggaggtttcctttccctatctt |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
32656851 |
tagagatcaactatgttgaagccttcagagagcaaatattagcttgttatcatggggctcaactttgcaaactgtggtggagatatcctttccctatctt |
32656752 |
T |
|
| Q |
119 |
ttgggatttcctcca |
133 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32656751 |
ttgggatttcctcca |
32656737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 56 - 130
Target Start/End: Complemental strand, 32581665 - 32581591
Alignment:
| Q |
56 |
attagcttgttatcatggggctcaactttgcaaactgctgtggaggtttcctttccctatcttttgggatttcct |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32581665 |
attagcttgttatcatggggctcaactttgcaaattgtggtggaggtttcctttccctatcttttgggatttcct |
32581591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 166 - 238
Target Start/End: Complemental strand, 32656654 - 32656582
Alignment:
| Q |
166 |
ccatcagtttttcctcgcccaaatcaagtcttttgccgcattttaactcgccactaatcactggtttgtatct |
238 |
Q |
| |
|
||||||||||||||| | |||||||||||| || || ||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
32656654 |
ccatcagtttttccttgtccaaatcaagtcattcgctgcatttttactcgtcactaatcactggtttttatct |
32656582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 285
Target Start/End: Complemental strand, 32581358 - 32581314
Alignment:
| Q |
241 |
cagtttccacatcaaacttatgatccctccctattatatgtatct |
285 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
32581358 |
cagtttccactacaaacttatgatccctccctactgtatgtatct |
32581314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University