View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18106_low_15 (Length: 299)
Name: NF18106_low_15
Description: NF18106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18106_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 2265515 - 2265653
Alignment:
| Q |
18 |
aaagctatactctatagcttttgcgaaatcataatggatcaccgaccatgattttgagaaaccctcggcttctttataattgtagttcttgcagaattat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265515 |
aaagctatactctatagcttttgcgaaatcataatggatcaccgaccatgattttgagaaaccctcggcttctttataattgtagttcttgcagaattat |
2265614 |
T |
|
| Q |
118 |
ttgttcttatctattaaccttaaaacgtcaaagcttctt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265615 |
ttgttcttatctattaaccttaaaacgtcaaagcttctt |
2265653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 167 - 290
Target Start/End: Original strand, 2265691 - 2265814
Alignment:
| Q |
167 |
cgtcaaaggaatatagagaaattaaagtaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
266 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265691 |
cgtcaaaggaatatagagaaattaaaggaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
2265790 |
T |
|
| Q |
267 |
atgaactcccactctgtgctgctc |
290 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
2265791 |
atgaactcccactcagtgctgctc |
2265814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University