View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_high_26 (Length: 383)
Name: NF18107_high_26
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_high_26 |
 | |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 269 - 383
Target Start/End: Complemental strand, 43238976 - 43238865
Alignment:
| Q |
269 |
aactagaatttcttttaaagagagaaaattttgcgttgttggtattgttaccattctctctcataggcttttttgttgttgttgttgtcaccgtctttat |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43238976 |
aactagaatttcttttaaagagagaaaattttgcggtgttggtattgttaccattctctctcataggcttttttgttgttgttgtt---accgtctttat |
43238880 |
T |
|
| Q |
369 |
tgacgtcatgttctt |
383 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
43238879 |
tgaagtcatgttctt |
43238865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 43239372 - 43239318
Alignment:
| Q |
18 |
atcatccctagaaaatcaatattgtttctttgcttgagttggcttctttaaaagc |
72 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43239372 |
atcatacctagaaaatcgatattgtttgtttgcttgagttggcttctttaaaagc |
43239318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 43246167 - 43246130
Alignment:
| Q |
21 |
atccctagaaaatcaatattgtttctttgcttgagttg |
58 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
43246167 |
atccctagaaaatcaatattgtttgtttacttgagttg |
43246130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 43252632 - 43252595
Alignment:
| Q |
21 |
atccctagaaaatcaatattgtttctttgcttgagttg |
58 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
43252632 |
atccctagaaaatcaatattgtttgtttacttgagttg |
43252595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University