View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_high_48 (Length: 273)
Name: NF18107_high_48
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 71 - 257
Target Start/End: Original strand, 43170023 - 43170210
Alignment:
| Q |
71 |
aatagagtgtaaaa-atttaatcaaatagcaaatcagtgacactgtcaaacttgcagctcgctagtaacttacttcaaattatgtaactagtctattttc |
169 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43170023 |
aatagagtgtaaaaaatttaatcaaatagcaaatcagtgacactgtcaaacttgcagctcgctagtaacttacttcaaattatgtaactaatctattttc |
43170122 |
T |
|
| Q |
170 |
taatttatacaaggcagcatattagaaaatcaaaatacttataaccacatgttcaaccagaaatcttataccggtactggtgggaatt |
257 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43170123 |
taatttatacaagacagcatattagaaaataaaaatacttataaccacatgttcaaccagaaatcttataccggtactggtgggaatt |
43170210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University