View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18107_high_54 (Length: 250)

Name: NF18107_high_54
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18107_high_54
NF18107_high_54
[»] chr2 (1 HSPs)
chr2 (12-231)||(171809-172028)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 231
Target Start/End: Original strand, 171809 - 172028
Alignment:
12 atgaatttgaaagaggaagctgctctttctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaattcttattggcacggtagta 111  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
171809 atgaatttgaaagaggaagctgctcttcctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaattcttattggcacggtagta 171908  T
112 ctgcacaattgtcaagattttctaattcagttgcaattcgaggtgattcacgaattgatatgagtggagactgtagtttgaactcacagtggttagagga 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||    
171909 ctgcacaattgtcaagattttctaattcagttgcaattcgaggtgattcacaacttgatatgagtggagactgtagtttgaactcacagtggttagagga 172008  T
212 tcagtttgatacgagatata 231  Q
    ||||||||||| ||||||||    
172009 tcagtttgatatgagatata 172028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University