View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_high_60 (Length: 243)
Name: NF18107_high_60
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_high_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 81 - 225
Target Start/End: Original strand, 43554856 - 43555000
Alignment:
| Q |
81 |
catgcaagcatagtaaagaaaactctttattttcacctgtgtggcctcttgatgcagcaatatgaaaacaggcttgatcaaaccctgccaatcctggctc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43554856 |
catgcaagcatagtaaagaaaactctttattttcacctgtgtggcctcttgatgcagcaatatgaaaacaggcttgatcaaaccctgccaatcctggctc |
43554955 |
T |
 |
| Q |
181 |
cacaatctcagatagattcaacaagaggtttaccaagtcaagatg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43554956 |
aacaatctcagatagattcaacaagaggtttaccaagtcaagatg |
43555000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 81 - 225
Target Start/End: Original strand, 43550540 - 43550684
Alignment:
| Q |
81 |
catgcaagcatagtaaagaaaactctttattttcacctgtgtggcctcttgatgcagcaatatgaaaacaggcttgatcaaaccctgccaatcctggctc |
180 |
Q |
| |
|
||||||| |||||| || |||||||||| || |||||||||| |||||| |||||||| ||| ||||| ||||||||||||||||| | | || || | |
|
|
| T |
43550540 |
catgcaaacatagtgaataaaactctttcttcccacctgtgtgccctcttactgcagcaacatggaaacaagcttgatcaaaccctgctacttcttgccc |
43550639 |
T |
 |
| Q |
181 |
cacaatctcagatagattcaacaagaggtttaccaagtcaagatg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43550640 |
cacaatctcagatagattcaacaagaggttcaccaagtcaagatg |
43550684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 43554776 - 43554808
Alignment:
| Q |
1 |
ttaatatctccctaaatagtagttcattactac |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43554776 |
ttaatatctccctaaatagtagttcattactac |
43554808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University