View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_high_61 (Length: 240)
Name: NF18107_high_61
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_high_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 36195073 - 36195284
Alignment:
| Q |
11 |
catcatcatattcagagcgatcggcggtgataaaatcaatcgagtgaaagagggatcaaccattgtagtgcgcaaggcaaggatacttatgtataaaggt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36195073 |
catcatcatattcagagcgatcggcggtgataaaatcaatcgagtgaaagagggatcaaccattgtagtgcgcaaggcaaggatacttatgtataaaggt |
36195172 |
T |
 |
| Q |
111 |
tcgatgagactcggtgttcgcagagcggaagacattgtagaagccccggagcctgcttccttcatagtcaaagaagattgtaactggtcgctcattgaat |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36195173 |
tcgatgagactcagtgttcgcagagcggaagacatagtagaagccccggagcctgcttccttcatagtcaaagaagattgtaactggtcgctcattgaat |
36195272 |
T |
 |
| Q |
211 |
tcgagcgagttc |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36195273 |
tcgagcgagttc |
36195284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 11 - 210
Target Start/End: Original strand, 36205479 - 36205675
Alignment:
| Q |
11 |
catcatcatattcagagcgatcggcggtgataaaatcaatcgagtgaaagagggatcaaccattgtagtgcgcaaggcaaggatacttatgtataaaggt |
110 |
Q |
| |
|
|||||||||||| |||| |||| | |||||| ||||| |||| ||||| |||||||| |||||| ||| |||||||| |||| | ||||| | |||| |
|
|
| T |
36205479 |
catcatcatattgcgagcagtcggtgctgataagatcaacagagtcaaagaaggatcaacaattgtactgcacaaggcaaagataatcatgtacagaggt |
36205578 |
T |
 |
| Q |
111 |
tcgatgagactcggtgttcgcagagcggaagacattgtagaagccccggagcctgcttccttcatagtcaaagaagattgtaactggtcgctcattgaat |
210 |
Q |
| |
|
||||||||||| |||||| ||||||| |||||||| | |||||||| ||||||| |||||| | |||||||||| ||||||| ||| ||||| |||| |
|
|
| T |
36205579 |
tcgatgagacttggtgtttgcagagctgaagacatcgaggaagcccc---gcctgctgccttcacaatcaaagaagactgtaacttgtctctcatcgaat |
36205675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University