View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_low_31 (Length: 370)
Name: NF18107_low_31
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 337; Significance: 0; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 12 - 356
Target Start/End: Original strand, 54456705 - 54457049
Alignment:
| Q |
12 |
atgatgatgatcagtggacggtggttttgctggcttccgagcaccattggccaccaacgaggcggcattacgacgagagatggagaaggaacaaatcagg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54456705 |
atgatgatgatcagtggacggtggttttgctggcttccgagcaccattggccaccaacgaggcggcattacgacgagagatggagaaggaacaaatccgg |
54456804 |
T |
|
| Q |
112 |
cgggatatgttgcggcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54456805 |
cgggatatgttgcggcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgt |
54456904 |
T |
|
| Q |
212 |
ggtcaaattctacaccgatgatgatgatgaaccctgttgctgttgatgcttcacaaccacctgaaatcaaacattttccacagaccagtggcaaggacaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54456905 |
ggtcaaattctacaccgatgatgatgatgaaccctgttgctgttgatgcttcacaaccacctgaaatcaaacattttccacagaccagtgacaaggacaa |
54457004 |
T |
|
| Q |
312 |
agttattctattggtcagtttcgtaactttttctattctcttctc |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54457005 |
agttattctattggtcagtttcgtaactttttctattctcttctc |
54457049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 15 - 229
Target Start/End: Original strand, 54056387 - 54056601
Alignment:
| Q |
15 |
atgatgatcagtggacggtggttttgctggcttccgagcaccattggccaccaacgaggcggcattacgacgagagatggagaaggaacaaatcaggcgg |
114 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| ||| | ||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
54056387 |
atgatgattagtggacggtggtttttctggctcccgggtaccgttggccaccaatgaggcggcattacgacgagagatcgagaaggaacaaatccggcgg |
54056486 |
T |
|
| Q |
115 |
gatatgttgcggcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggt |
214 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| | |||| |
|
|
| T |
54056487 |
gatatgttgaggcggatggagttggaggaggaagtgaggagggagcttgcaatggagggggcgtttggaaccatgcagaggcctctcaattctctatggt |
54056586 |
T |
|
| Q |
215 |
caaattctacaccga |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
54056587 |
caaattctacaccga |
54056601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 355
Target Start/End: Original strand, 54056600 - 54056661
Alignment:
| Q |
294 |
gaccagtggcaaggacaaagttattctattggtcagtttcgtaactttttctattctcttct |
355 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| | || ||||||| ||| |||| |
|
|
| T |
54056600 |
gacctgtgacaaggacaaagttattctattggtcagtttcattacgttttctactcttttct |
54056661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 121 - 193
Target Start/End: Complemental strand, 15039967 - 15039895
Alignment:
| Q |
121 |
ttgcggcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcaga |
193 |
Q |
| |
|
||||||| || ||| |||||||| || ||| |||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
15039967 |
ttgcggcagaaagaattggaggaggaggtgtggagggagcttgcaatggagaggacgtttggaaccatgcaga |
15039895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 303 - 355
Target Start/End: Complemental strand, 15039809 - 15039756
Alignment:
| Q |
303 |
caaggacaaagttattctattggtca-gtttcgtaactttttctattctcttct |
355 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
15039809 |
caaggacaaaattattctattggtaaagtttcataactttttctattctcttct |
15039756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University