View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18107_low_36 (Length: 352)

Name: NF18107_low_36
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18107_low_36
NF18107_low_36
[»] chr1 (2 HSPs)
chr1 (124-331)||(32952392-32952597)
chr1 (1-42)||(32952269-32952310)
[»] chr4 (1 HSPs)
chr4 (157-216)||(1748250-1748309)


Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 124 - 331
Target Start/End: Original strand, 32952392 - 32952597
Alignment:
124 ccgaattttcaaatatgacacagcgagaaccgttaacaatgacttacaacacaaagagaagggttatgatggttagcatagttcttgaactgacccctca 223  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||  |||||||||||||||||||||||||||||||||||||||||    
32952392 ccgaattttcaaatatgacacagcgagaaccgctaacaatgacttataacacataga--agggttatgatggttagcatagttcttgaactgacccctca 32952489  T
224 aattggcccctacattttagaaatgtggggtgaaaaataattgtttgctatgttcatagtttaaataatggtttttgattattattgcttgtaattggat 323  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||    
32952490 aattggcccctacattttagaaatgtggggtgaaaaataattgtttgctatgttcatagtttaaataatggtttatgattcttattgcttgtaattggat 32952589  T
324 attcaggc 331  Q
    ||||||||    
32952590 attcaggc 32952597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 32952269 - 32952310
Alignment:
1 atacaatcaaataatccctaaaatcaaataaaactaatggaa 42  Q
    |||||||||||||||||||||||||||||| |||||||||||    
32952269 atacaatcaaataatccctaaaatcaaatacaactaatggaa 32952310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 157 - 216
Target Start/End: Original strand, 1748250 - 1748309
Alignment:
157 taacaatgacttacaacacaaagagaagggttatgatggttagcatagttcttgaactga 216  Q
    ||||||||||||  |||||||||||  | |||||||||||||| ||||||||| ||||||    
1748250 taacaatgacttgaaacacaaagagtggagttatgatggttagtatagttcttaaactga 1748309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University