View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_low_36 (Length: 352)
Name: NF18107_low_36
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 124 - 331
Target Start/End: Original strand, 32952392 - 32952597
Alignment:
| Q |
124 |
ccgaattttcaaatatgacacagcgagaaccgttaacaatgacttacaacacaaagagaagggttatgatggttagcatagttcttgaactgacccctca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32952392 |
ccgaattttcaaatatgacacagcgagaaccgctaacaatgacttataacacataga--agggttatgatggttagcatagttcttgaactgacccctca |
32952489 |
T |
|
| Q |
224 |
aattggcccctacattttagaaatgtggggtgaaaaataattgtttgctatgttcatagtttaaataatggtttttgattattattgcttgtaattggat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
32952490 |
aattggcccctacattttagaaatgtggggtgaaaaataattgtttgctatgttcatagtttaaataatggtttatgattcttattgcttgtaattggat |
32952589 |
T |
|
| Q |
324 |
attcaggc |
331 |
Q |
| |
|
|||||||| |
|
|
| T |
32952590 |
attcaggc |
32952597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 32952269 - 32952310
Alignment:
| Q |
1 |
atacaatcaaataatccctaaaatcaaataaaactaatggaa |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32952269 |
atacaatcaaataatccctaaaatcaaatacaactaatggaa |
32952310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 157 - 216
Target Start/End: Original strand, 1748250 - 1748309
Alignment:
| Q |
157 |
taacaatgacttacaacacaaagagaagggttatgatggttagcatagttcttgaactga |
216 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||| ||||||||| |||||| |
|
|
| T |
1748250 |
taacaatgacttgaaacacaaagagtggagttatgatggttagtatagttcttaaactga |
1748309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University