View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_low_40 (Length: 334)
Name: NF18107_low_40
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 19 - 322
Target Start/End: Complemental strand, 42996309 - 42996007
Alignment:
| Q |
19 |
atatttaatatttgcgtgcgtcattcaatagaagattatttattcttattatattgtttcatgtatgtattgactaagtcatgcacnnnnnnnactattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42996309 |
atatttaatatttgcgtgcgtcattcaatagaagattatttattcttattatattgtttcatgtatgtattgactaagtcatgcactttttttactattc |
42996210 |
T |
 |
| Q |
119 |
ctaaattaatgctactaccgttttcatgcttgactactctctaatgcatgcatgcttcccatattttcaattatatgtttccactatagtatagtagcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
42996209 |
ctaaattaatgctactaccgttttcatgcttgactactctctaatgcatgcatgcttcccatattttccaat-tatgtttccactatagtatagtagcaa |
42996111 |
T |
 |
| Q |
219 |
cttcttgtacgtatgtgtctatactctacatacctgaaagtataataccttcttccatctctaacgacaaatattgagcattcatcagtaggataaaatg |
318 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42996110 |
cttcttgtacgtgtgtgtctatactctacatacctgaaagtataataccttcttccatctctaacgacaaatattgagcattcatcagtaggataaaatg |
42996011 |
T |
 |
| Q |
319 |
atga |
322 |
Q |
| |
|
|||| |
|
|
| T |
42996010 |
atga |
42996007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University