View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_low_49 (Length: 295)
Name: NF18107_low_49
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_low_49 |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 45846570 - 45846291
Alignment:
| Q |
1 |
agaaattatttctatatccaaaattgcttttcccatgattttcaccggtctcttactctattgtcgttcaatgatctccatgctctttcttggtcacctc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45846570 |
agaagttatttctatatccaaaattgcttttcccatgattttcaccggtcttttactctattgtcgttcaatgatctccatgctctttcttggtcacctc |
45846471 |
T |
 |
| Q |
101 |
ggcgaacttgccttagccggcggttcactcgctgtcggctttgcgaacattaccggttactcaatcctctctggtctcgccgttggaatggaacctattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45846470 |
ggcgaacttgccttagccggcggttcactcgcggtcggctttgcgaacattaccggttactcaatcctctccggtctcgccgttggaatggaacctattt |
45846371 |
T |
 |
| Q |
201 |
gtggacaagcttttggtgccaaaagattcactctccttggtctatgtttacaaaaaaccattctcttgctactcttaact |
280 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45846370 |
gtggacaagcttttggtgcaaaaagattcactctccttggtctatgtttacaaaaaaccattctcttgctactcttaact |
45846291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 71 - 270
Target Start/End: Original strand, 23617 - 23816
Alignment:
| Q |
71 |
atgatctccatgctctttcttggtcacctcggcgaacttgccttagccggcggttcactcgctgtcggctttgcgaacattaccggttactcaatcctct |
170 |
Q |
| |
|
||||| || ||||| ||||||||||||||| || ||||| |||| || || || || ||| | || ||||| ||||| || |||||||| || || | |
|
|
| T |
23617 |
atgatttcaatgctttttcttggtcacctcaatgaccttgcactagctggtgggtcccttgctattggttttgccaacatcactggttactccattcttt |
23716 |
T |
 |
| Q |
171 |
ctggtctcgccgttggaatggaacctatttgtggacaagcttttggtgccaaaagattcactctccttggtctatgtttacaaaaaaccattctcttgct |
270 |
Q |
| |
|
||||||| || ||||| |||||||| |||||||| |||||||||||||| |||| ||||||||| |||||||| ||| | |||| ||||||||| ||||| |
|
|
| T |
23717 |
ctggtcttgctgttggtatggaaccaatttgtggtcaagcttttggtgctaaaaaattcactcttcttggtctttgtcttcaaagaaccattcttttgct |
23816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 140 - 241
Target Start/End: Original strand, 2989822 - 2989923
Alignment:
| Q |
140 |
tttgcgaacattaccggttactcaatcctctctggtctcgccgttggaatggaacctatttgtggacaagcttttggtgccaaaagattcactctccttg |
239 |
Q |
| |
|
||||| ||||| || |||||||| || ||||||||||| ||| | |||||||||||||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
2989822 |
tttgcaaacatcacaggttactccattctctctggtcttgccatgggaatggaacctatttgtggtcaagcttttggtgctaaaagattcaaactccttg |
2989921 |
T |
 |
| Q |
240 |
gt |
241 |
Q |
| |
|
|| |
|
|
| T |
2989922 |
gt |
2989923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University