View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18107_low_52 (Length: 273)

Name: NF18107_low_52
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18107_low_52
NF18107_low_52
[»] chr4 (1 HSPs)
chr4 (71-257)||(43170023-43170210)


Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 71 - 257
Target Start/End: Original strand, 43170023 - 43170210
Alignment:
71 aatagagtgtaaaa-atttaatcaaatagcaaatcagtgacactgtcaaacttgcagctcgctagtaacttacttcaaattatgtaactagtctattttc 169  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
43170023 aatagagtgtaaaaaatttaatcaaatagcaaatcagtgacactgtcaaacttgcagctcgctagtaacttacttcaaattatgtaactaatctattttc 43170122  T
170 taatttatacaaggcagcatattagaaaatcaaaatacttataaccacatgttcaaccagaaatcttataccggtactggtgggaatt 257  Q
    ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43170123 taatttatacaagacagcatattagaaaataaaaatacttataaccacatgttcaaccagaaatcttataccggtactggtgggaatt 43170210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University