View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_low_59 (Length: 250)
Name: NF18107_low_59
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 231
Target Start/End: Original strand, 171809 - 172028
Alignment:
| Q |
12 |
atgaatttgaaagaggaagctgctctttctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaattcttattggcacggtagta |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171809 |
atgaatttgaaagaggaagctgctcttcctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaattcttattggcacggtagta |
171908 |
T |
|
| Q |
112 |
ctgcacaattgtcaagattttctaattcagttgcaattcgaggtgattcacgaattgatatgagtggagactgtagtttgaactcacagtggttagagga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171909 |
ctgcacaattgtcaagattttctaattcagttgcaattcgaggtgattcacaacttgatatgagtggagactgtagtttgaactcacagtggttagagga |
172008 |
T |
|
| Q |
212 |
tcagtttgatacgagatata |
231 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
172009 |
tcagtttgatatgagatata |
172028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University