View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_low_68 (Length: 235)
Name: NF18107_low_68
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 25587048 - 25586968
Alignment:
| Q |
18 |
ctactttcttaatgatgggtgatattgcaacaatcaaaatcaaaatatgatacctacttttatacgagtttcagccctctt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25587048 |
ctactttcttaatgatgggtgatattgcaacaatcaaaatcaaaatatgatacctacttttgtacgagtttcggccctctt |
25586968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 25586903 - 25586858
Alignment:
| Q |
163 |
gtgattttttgaaagaaagtgttactttaactataagaaattcctt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25586903 |
gtgattttttgaaagaaagtgttactttaactataagaaattcctt |
25586858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University