View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_low_70 (Length: 232)
Name: NF18107_low_70
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_low_70 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 952416 - 952610
Alignment:
| Q |
15 |
aagaatagttaggtaaacggatatcctctgcatttggggggtctcctacgaccatggcatcggccttcatcatgttcattttaagaacaactataattct |
114 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
952416 |
aagaatagttaggtaaacggatgtcctctgcgtttggggggtctcctacgaccatggcatcggccttcatcatgttcattttaagaacaacgataattct |
952515 |
T |
 |
| Q |
115 |
gttaaaaacataaacgagatagatagatagttaataaacgcgtgtaatgtagaataaaaatgataattgtgtaaaaatagaggaagtgatgcattactt |
213 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
952516 |
gttaaaaacataaacg----agatagatagttaataaaggcgtgtaatgtagaataaaaatgataattgtgtaaaaatagaggaagtgatgcattactt |
952610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University