View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18107_low_75 (Length: 212)
Name: NF18107_low_75
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18107_low_75 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 2592848 - 2593020
Alignment:
| Q |
16 |
agagaagaattgcaggttcgaactcacatcacaatgtatcaaatgatctagcaaccttataaaatctaagccgcacttaaatgtactttacatttatcaa |
115 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2592848 |
agagaagaattgtaggttcgaacttacatcacaatgtatcaaataatctagcaaccttataaaatctaagccgcacttaaatgtactttaaatttatcaa |
2592947 |
T |
|
| Q |
116 |
agttcaagagtagttgttgatgttttgacttcgaactcaaatatcacacgaataaatttagatgtgtggaata |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2592948 |
agttcaagagtagttgttgatgttttgacttcgaactcaaatatcacacgaataaatttagatgtgtgaaata |
2593020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 182
Target Start/End: Original strand, 32576065 - 32576101
Alignment:
| Q |
146 |
tcgaactcaaatatcacacgaataaatttagatgtgt |
182 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
32576065 |
tcgaactcaaatctcacactaataaatttagatgtgt |
32576101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University