View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18108_low_19 (Length: 350)
Name: NF18108_low_19
Description: NF18108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18108_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 9e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 20 - 138
Target Start/End: Complemental strand, 38270439 - 38270321
Alignment:
| Q |
20 |
atgaatccagtaaagctttttccaaggacataaagtttgaaagtggagaagctgagaataatttctctggtgaggatgaggtgaattctatgtggagaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38270439 |
atgaatccagtaaagctttttccaaggacataaagtttgaaagtggagaagctgagaataatttctctggtgaggatgaggtgaattctatgtggagaga |
38270340 |
T |
|
| Q |
120 |
agctttcatgaaggcatac |
138 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38270339 |
agctttcatgaaggcatac |
38270321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 257 - 346
Target Start/End: Complemental strand, 26610164 - 26610075
Alignment:
| Q |
257 |
ggattggaaccgcaagagcaattttaccaaattattatgttgtttatgttttacattttgtgtcacattgaaaccacttatttggttttg |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
26610164 |
ggattggaaccgcaagagcaattttaccaaattattatattgtttatgttttagactttgtgtcacattgaaaccacttatttggttttg |
26610075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University