View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18108_low_22 (Length: 341)
Name: NF18108_low_22
Description: NF18108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18108_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 1767887 - 1768118
Alignment:
| Q |
16 |
attcatcaaatagcaggttaaattcacaagagtgattgttttttcattgacgaagtgataaacacaccaccctaaattcacacatacaattattagatag |
115 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1767887 |
attcatcaaatcgcgggttaaattcacaagagtaattgttttttcattgacgaagtgataaacacaccaccctaaattcacacatacaattattagatag |
1767986 |
T |
 |
| Q |
116 |
tagatttgaacctaaataaaagtgttaatttagtctaacaaattcgacattactcattgaactagatctaagctactaatgatgcattttatattaagtt |
215 |
Q |
| |
|
| |||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1767987 |
tggatttgaaccaaaataaaagtg----tttagtctaacaaattcgacattactcatggaactagatctaagctactaatgatgcattttatattaagtt |
1768082 |
T |
 |
| Q |
216 |
tgtaccgttaaacaaacacctcgtagtgaagtactt |
251 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| |
|
|
| T |
1768083 |
tgtaccgttaaataaacacctcgtagtgaagcactt |
1768118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University