View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18108_low_27 (Length: 285)
Name: NF18108_low_27
Description: NF18108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18108_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 114 - 271
Target Start/End: Original strand, 49297199 - 49297351
Alignment:
| Q |
114 |
atatgttttactataatctgagtagaagttctctgcttaaattatccagcatctaggctcctgatatgagctatacgggcctttcctttaattttcaagt |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49297199 |
atatgttttactataatctgagtaaaagttctctgcttaaattatccagcatctaggctcctgatatgagctatacgggcctttcc-----ttttcaagt |
49297293 |
T |
 |
| Q |
214 |
ataacttgctagtttgtgatggtctagttatccttttcaaaaccatatcattattttg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49297294 |
ataacttgctagtttgtgatggtctagttatccttttcaaaaccatatcattattttg |
49297351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University