View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18108_low_32 (Length: 239)

Name: NF18108_low_32
Description: NF18108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18108_low_32
NF18108_low_32
[»] chr8 (1 HSPs)
chr8 (18-121)||(18731809-18731912)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 18731809 - 18731912
Alignment:
18 tttaactgacaatgaatatagaatatcataatgacaatgtggtgagctatctttatttgacctttttatgatattctatgttttggctgccatattctcc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18731809 tttaactgacaatgaatatagaatatcataatgacaatgtggtgagctatctttatttgacctttttatgatattctatgttttggctgccatattctcc 18731908  T
118 ttat 121  Q
    ||||    
18731909 ttat 18731912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University