View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18108_low_32 (Length: 239)
Name: NF18108_low_32
Description: NF18108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18108_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 18731809 - 18731912
Alignment:
| Q |
18 |
tttaactgacaatgaatatagaatatcataatgacaatgtggtgagctatctttatttgacctttttatgatattctatgttttggctgccatattctcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18731809 |
tttaactgacaatgaatatagaatatcataatgacaatgtggtgagctatctttatttgacctttttatgatattctatgttttggctgccatattctcc |
18731908 |
T |
|
| Q |
118 |
ttat |
121 |
Q |
| |
|
|||| |
|
|
| T |
18731909 |
ttat |
18731912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University