View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18108_low_39 (Length: 212)
Name: NF18108_low_39
Description: NF18108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18108_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 61 - 198
Target Start/End: Original strand, 5574759 - 5574896
Alignment:
| Q |
61 |
aatactgaaggatgtttagcttgatagtttagtgatagaaaatccatttttgttttcattctgcatcaaaggaccattacagtaagccatggtttagtga |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5574759 |
aatactgaaggatgtttagcttgatagtttagtgatagaaaatccatttttgttttcattctgcatcaaaggaccattacagtaagccatggtttagtga |
5574858 |
T |
 |
| Q |
161 |
agcctgaactatatgtatatcattatatgaccttattg |
198 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5574859 |
agcctgaactatatgtatatcatcatatgaccttattg |
5574896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University