View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18108_low_40 (Length: 211)
Name: NF18108_low_40
Description: NF18108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18108_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 16 - 179
Target Start/End: Complemental strand, 46796032 - 46795876
Alignment:
| Q |
16 |
atgaaaattgacaaaacaaaaagcttagtaagtaatatggggaaaagcattggagttagagnnnnnnnnnnnnnncttatatttggcaaataaaaattga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46796032 |
atgaaaattgacaaaacaaaaagcttagtaagtaatatgggg-aaagcattggagttagagacacacacacacatcttatatttggcaaataaaaattga |
46795934 |
T |
|
| Q |
116 |
agctcggcggttatgtctgggtgaagatggggaatcaagaaaggaaacatgaggtcatatggca |
179 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795933 |
agctcggcgg------ctaggtgaagatggggaatcaagaaaggaaacatgaggtcatatggca |
46795876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University